Submit Your Article CMED MEACR meeting
Home Print this page Email this page Users Online: 363
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 9  |  Issue : 5  |  Page : 186-192

Association between ICOS polymorphisms and immune thrombocytopenia in an Iranian population


1 Thalassemia and Hemoglobinopathy Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences; Department of Laboratory Sciences, School of Allied Medical Sciences, Ahwaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2 Thalassemia and Hemoglobinopathy Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
3 Department of Laboratory Sciences, School of Allied Medical Sciences, Ahwaz Jundishapur University of Medical Sciences, Ahvaz, Iran

Date of Submission03-Mar-2020
Date of Decision13-Jun-2020
Date of Acceptance15-Jul-2020
Date of Web Publication12-Oct-2020

Correspondence Address:
Najmaldin Saki
Thalassemia and Hemoglobinopathy Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ccij.ccij_35_20

Rights and Permissions
  Abstract 


Context: Immune thrombocytopenia (ITP) is an autoimmune disease that is caused by the dysregulation of immune system, in which the circulating platelets (Plt) are destroyed by reticuloendothelial system, leading to hemorrhagic manifestations in patients. Aims: Recent studies have indicated that polymorphisms can contribute to ITP susceptibility and outcome. Given the importance of follicular helper T (Tfh) cells in ITP, we evaluated polymorphism in Inducible T-cell Costimulator (ICOS) as a Tfh surface marker among ITP patients to find a likely prognostic factor. Subjects and Methods: We recruited 54 ITP patients and 46 persons with no history of thrombocytopenia to conduct this case–control study. In addition to routine laboratory parameters, three polymorphisms, namely rs10932036, rs4404254, and rs10932037 of ICOS gene, were assessed by polymerase chain reaction. Statistical Analysis: Mann–Whitney, Kruskal–Wallis, and Chi-square tests were employed to compare and evaluate the data, and P < 0.05 indicated a statistically significant association. Results: The findings of our study showed that allele and genotype frequencies of all three polymorphisms in question were similar between case and control with no significant difference. However, our assessment indicated higher mean Plt counts in RS4404254 CC genotype than other genotypes under investigation. Conclusions: It seems that rs10932037, rs4404254, and rs10932036 polymorphisms of ICOS gene are not involved in susceptibility to ITP. Nevertheless, we found that those carrying RS4404254CC polymorphism have better prognosis due to higher Plt counts both in acute and chronic ITP patients.

Keywords: Autoimmune, immune thrombocytopenia, inducible costimulator, platelet disorder, polymorphism


How to cite this article:
Purrahman D, Jaseb K, Kaydani GA, Saki N. Association between ICOS polymorphisms and immune thrombocytopenia in an Iranian population. Clin Cancer Investig J 2020;9:186-92

How to cite this URL:
Purrahman D, Jaseb K, Kaydani GA, Saki N. Association between ICOS polymorphisms and immune thrombocytopenia in an Iranian population. Clin Cancer Investig J [serial online] 2020 [cited 2020 Dec 2];9:186-92. Available from: https://www.ccij-online.org/text.asp?2020/9/5/186/297996




  Introduction Top


Immune thrombocytopenia (ITP) is an autoimmune disorder that results from a defect in peripheral tolerance where the circulating platelet (Plt) counts reach <100 × 109/L.[1],[2] The incidence of ITP ranges 4–10 per 100,000 people and bleeding in the skin and mucosa is the most frequent manifestation of it.[2],[3],[4],[5],[6] The most distinguished classification of ITP relates to acute and chronic disease, which is based on evaluating the course of disease as well as patient's age and is crucial for therapeutic approaches.[4],[7] ITP can also be secondary to other conditions such as infection (human immunodeficiency virus, hepatitis C virus, and Helicobacterpylori) or primary immune deficiency (autoimmune lymphoproliferative syndrome and common variable immune deficiency). However, 80% of ITP cases are primary, which is more difficult to treat than secondary ITP.[3],[4],[6]

Until now, foreign studies on ITP patients from Iran have not addressed the prevalence of ITP in this country; however, we investigated Persian researches stating that ITP prevalence in Iran is similar to international studies. In addition, corticosteroids and intravenous immunoglobulin are commonly used for acute patients and immunosuppressive drugs such as rituximab for chronic patients.[8]

Previous studies indicate that cellular immune dysfunction, which occurs due to imbalance and disruption of T-cells, plays a central role in ITP drive.[1],[6],[9] CD28 family receptors are involved in costimulatory signaling of T-cells, which is essential for the activation and proliferation of T-cells.[10] A prominent member of this family is CD28, the downregulation of which has been shown to cause T-cell dysfunction.[10] Studies have also revealed that blocking the interaction of CD28 family members leads to glycoprotein-specific T-cell tolerance.[6],[9]

Inducible T-cell costimulator (ICOS) or CD278 (2q33) is a member of CD28 family that is extensively associated with the structure and function of CD28.[11] Various subsets of T-cells express ICOS, including follicular helper T (Tfh) with phenotypic feature of CD3+ CD5+ CXCR5+ ICOS + PD-1+.[7],[12] By releasing Interleukin (IL)-21, Tfh has a potential role in the production of Auto-antibody against common Plt surface glycoproteins (e.g., GP IIb/IIIa).[3],[13],[14] Cell surface ICOS of TFH interacts with its ligand (CD275 or ICOS-L) on B-cell surface, prolonging cell–cell contact through Ab-affinity maturation, B-cell survival, and plasma cell (PC) differentiation.[11],[15],[16] A study by Xie et al. showed that Tfh from ITP patients is of ICOS high type. Moreover, the quantity of ICOS high Tfh cells of ITP patients is greater than healthy controls (HC). In addition, their research detected a positive correlation between ICOS high and/or PD-1high with serum levels of IL-21 in patients.[12] Similar assessments on humans and mice revealed that the absence of ICOS was associated with a severe decrease in CXCR5+ CD4+ Tfh cells in germinal centers and peripheral blood.[17] On the other hand, studies conducted on other autoimmune diseases (AID) such as systemic lupus erythematosus (SLE), autoimmune thyroid disease, rheumatoid arthritis (RA), and Sjögren's syndrome have indicated that high expression of ICOS along with CXCR5+ and CD4+ as circulating Tfh cell markers is closely linked to Auto-antibody production in these AIDs.[12]

No gold standard has been developed for ITP; therefore, several studies have evaluated various factors (including differences in specific genetic backgrounds) and their association with ITP.[1],[4] Given the importance of ICOS signaling in ITP pathogenesis [9] and the evaluation of ICOS expression levels in Tfh cells of ITP patients, ICOS gene polymorphisms are likely to affect ITP pathogenesis by changing the expression of ICOS. Nevertheless, to our knowledge, no study has investigated the correlation between ICOS gene polymorphism with ITP to this date. In this research, we aimed to achieve a new diagnostic and prognostic factor in ITP by evaluating three polymorphisms of ICOS gene in a cohort of 100 subjects.


  Subjects and Methods Top


Study sample characteristics

To perform this case–control study, we enrolled 54 patients with ITP (24 males and 30 females) who referred to Baqa'i Hospital of Ahvaz in 2019. Inclusion criteria were physical examination, history, and laboratory results such as Plt counts <100 × 109/L plus normal hemoglobin and White blood cell (WBC) counts as well as the absence of concomitant disease with thrombocytopenia such as SLE, current diagnosis of malignancy, and viral disease.[15],[18] Furthermore, given the differences in laboratory parameters as well as medication between acute and chronic ITP patients, we subdivided our subjects into acute and chronic groups according to disease duration and age [Figure 1]. In addition, 46 subjects without ITP nor other autoimmune diseases who were matched for age and sex were recruited as HC group. The demographic characteristics of our study population are summarized in [Table 1]. It should be noted that the Ethics Committee of AJUMS Research Deputy approved this study with IR.AJUMS.REC.1397.676 ethics code.
Figure 1: Flow diagram showing patient selection and exclusion, polymerase chain reaction, and laboratory examination. ITP indicates immune thrombocytopenia

Click here to view
Table 1: Demographic features of subjects

Click here to view


DNA extraction and genotyping

2 ml of EDTA-anticoagulated blood (SL/Italy) was drawn from the subjects and the DNA was extracted using a commercial kit according to the manufacturer's instructions (Roche/Germany). The appropriateness of the extracted DNA was confirmed by a Thermo Scientific NanoDrop Spectrophotometer (Onec) and the samples were stored at −70°C for later steps. Due to the limited number of studies on ICOS polymorphisms in AID, the polymorphism located in regulatory region of ICOS gene was considered as well as available publications on these polymorphisms.[16],[19] Therefore, the three polymorphisms of rs10932036, rs10932037 (c. 1624C > T), and rs4404254 from ICOS gene were selected for assessment in ITP.

In the study plan, a primer pair was designed for polymerase chain reaction (PCR) because of the proximity of polymorphisms to each other. The primer sequence is as follows: Forward: TTCTTTCCTCTGCTGCTCAA and Reverse: GGAGTCTCTCAACCCTGGAA. Our PCR reactions involved 25 λ of reaction mixture. Each tube contained 0.25 λ of each primer (1:2 dilution), 12.5 λ of distilled water, 10 λ of commercial master mix (Amplicon/Denmark), and finally 2 λ of sample. To prepare PCR product, 2x thermocycler (Peqlab Biotechnologie Gmbh) with the cycle of heat lid to 110.0°C, 94.0°C for 5 min, 72°C for min, 60.0°C for 1.0 min, and 94.0°C for 1.0 min 30x start cycle (1.0) was used. To control the work, the samples were loaded onto 2% agarose gel, which formed a band at 500 bp [Figure 2] and no samples were missed during these steps. Finally, the ABI PRISM 3130 × 1 DNA Analyzer was employed using SANGER sequencing [Figure 3].
Figure 2: Running ICOS polymorphism samples in agarose gel together with Leder 50. All the samples formed bands at 500 bp region

Click here to view
Figure 3: Sequence of Rs4404254T>C polymorphisms. (a-c) Homozygous major, heterozygous, and homozygous minor alleles in Rs4404254T>C polymorphism, respectively

Click here to view


Statistical analysis

Mean and SD were used for numerical data, as well as frequency and percentage for qualitative data. The frequencies of alleles and genotypes were obtained by direct counting. Comparing the resulting frequency with the expected one, Hardy–Weinberg equilibrium (HWE) was evaluated by Chi-square and odds ratio and confidence interval was also estimated. Logistic regression was employed to analyze the values of laboratory parameters in the study population. Mann–Whitney, Kruskal–Wallis, and Chi-square tests were used to investigate the significance of polymorphism association with susceptibility to ITP. All analyses were performed with SPSS (IBM Corporation, Armonk, NY, USA) 25.0 version, and P < 0.05 was considered as the significance level.


  Results Top


Comparison of demographic characteristics between patients and healthy controls

This study was conducted on 54 patients whose features are summarized in [Table 1]. There were 40 acute ITP patients (19 males and 21 females) and the remainder (14 patients) were in the chronic phase (5 males and 9 females). The mean age of patients in chronic and acute group was 36.00 ± 13.00 and 12.16 ± 6.66 years, respectively. The mean Plt counts in acute and chronic groups was 31.50 × 109/L and 29.85 × 109/L, respectively, and the mean difference in Plt counts of case and control groups (265.50 × 109/L) was potentially significant (P< 0.001). In addition to Plts, the difference in other relevant laboratory parameters, namely mean platelet volume (MPV) and platelet distribution width (PDW), was also significant between case and control groups (P < 0.002 and <0.001, respectively).

Allele frequencies and genotypes distribution

By comparing the genotype distribution obtained in this study and the expected frequency with regard to similar studies, it was found that the frequencies of our study were in agreement with HWE.[11],[19],[20] The frequency of ICOS gene polymorphisms and alleles is summarized in [Table 2]. Investigation of rs10932037C >T polymorphism revealed that the expression pattern of genotype in acute and chronic groups was similar to HC group and was not statistically significant (P = 0.955). Moreover, no subject in either populations was a homozygous carrier of RS10932037C >T minor alleles. rs10932037C >T polymorphism alleles also had a similar distribution in case and control groups without a significant difference (P = 0.955).
Table 2: Distribution of ICOS alleles and genotypes

Click here to view


Assessment of rs4404254T >C indicated the presence of all three genotypes of this polymorphism in case and control groups. The genotype distribution pattern showed a difference between chronic and acute groups, which was not statistically significant (P = 0.609). There was no significant difference in the frequency of case and HC genotypes (P = 0.882), either. Besides, the frequency of T and C alleles of Rs4404254 polymorphism was similar in the studied groups without significant difference (P = 0.652).

Investigation of rs10932036A > T polymorphism revealed the lack of TT (minor homozygous allele) genotype carriers in the population under study. The frequency of AA and AT genotypes was similar in case–control as well as in acute and chronic groups and was not statistically significant (P = 0.726 and 0.948, respectively). Moreover, the frequency of A and T alleles did not show any significant difference between groups (P = 0.726).

Relationship between polymorphisms and laboratory indices at diagnosis

According to [Table 3], we examined the association of routine laboratory parameters with genotype of each polymorphism in our study groups. No significant difference was found in the majority of indices such as red blood cells, hematocrit, MPV, and PDW; however, the results of Plt counts showed that carriers of rs4404254CC genotype had higher mean counts than the other two genotypes of this polymorphism, which was statistically significant (P = 0.028). Higher Plt counts have been observed in rs10932036AT and rs10932037CT as well as rs4404254CC; nonetheless, their statistical analysis did not indicate a significant difference (P = 0.083 and 0.054, respectively). MPV and PDW were also separately considered in acute and chronic groups as two important parameters of ITP [Table 4]. Although none of the correlations was significant, Rs4404254CC and RS10932036AT in acute group, respectively, showed the highest mean PDW and lowest mean MPV.
Table 3: Relationship between laboratory parameters with genotype of each polymorphism in patient group

Click here to view
Table 4: Relationship of inducible costimulator polymorphism with mean platelet volume and platelet distribution width among patients

Click here to view


Association of polymorphisms with platelet counts before and after treatment

After the patients achieved remission, the association of each polymorphism with Plt counts at diagnosis and remission was investigated separately in both acute and chronic groups [Table 5]. Assessment of mean values indicated a higher Plt count before and after treatment in acute patients with RS10932037CT genotype; however, the difference was not statistically significant (P = 0.089 and 0.092, respectively). The difference in Plt counts before and after therapy was not significant for other genotypes under study, either in acute or chronic groups.
Table 5: Relationship of inducible costimulator gene polymorphisms with platelet counts before and after treatment

Click here to view



  Discussion Top


ITP is a autoimmune disorder in which T-cell dysfunction (especially Tfh) plays a major role.[12] ICOS or CD278 is a Tfh surface marker that is essential in the pathogenesis of autoimmune diseases such as ITP due to its involvement in PC differentiation process and isotype switching.[20],[21] Studies have suggested the association of ICOS polymorphisms with susceptibility to autoimmune diseases such as type I diabetes, RA, and systemic sclerosis.[22],[23],[24] Nevertheless, to the best of our knowledge, the relationship between ICOS gene polymorphisms with ITP and related indices has not been investigated so far. We assessed three ICOS polymorphisms in a 100-person cohort of Iranian population, assuming that ICOS gene polymorphisms could affect ITP through altering protein level. The polymorphisms selected in our research are located in 3'-untranslated region (3'-UTR). 3'-UTR may affect mRNA stability, degradation, and Post-transcriptional regulation because of its importance in binding of the regulatory element.[25],[26]

One of the investigated polymorphisms is Rs10932037C >T, which was previously shown in two independent studies to correlate with the level of ICOS mRNA because of its location in miRs binding site regulating the ICOS expression level. Conversely, our research did not show a significant difference between genotype frequency with RS10932037C >T alleles in ITP patients and controls. In this case, the assumption that rs10932037C >T polymorphism is involved in ITP is rejected. Moreover, the results of RS10932036A >T do not show any association with ITP; however, a previous study confirmed the correlation of this polymorphism with RA.[22]

RS4404254T >C polymorphism is also a non-coding single-nucleotide polymorphism that does not affect the amino acid sequence.[27] Our results showed that the frequency of genotype and allele distribution of Rs4404254 was similar in case and control groups, a finding rejecting the assumption of RS4404254T >C involvement in ITP. Nonetheless, patients carrying the CC genotype in our research showed higher mean Plt counts (both acute and chronic) at the time of diagnosis. Therefore, carriers of this genotype appear to be associated with a better prognosis compared to two other genotypes, which is a finding difficult to justify and may be related to lower WBC counts in carriers of this CC genotype [Table 3]. Given the role ICOS plays in the activation and proliferation of T-cells,[18] we assume that the CC genotype decreases the number and function of Tfh-cells by reducing the ICOS function, which, in turn, reduces Plt degradation. In agreement with our results, Haimila et al. suggested that the presence of minor T allele in RS4404254T >C polymorphism is related with lack of or delayed graft function, indicating a higher level of immunity in the presence of T allele.[27] A survey of an immune disease called IgA nephropathy revealed a significant association with T allele carriers (TT and CT).[28] Nevertheless, the study of RS4404254T >C polymorphism in nonsegmental vitiligo and RA Immune disease revealed no association between this polymorphism with these diseases nor their associated indexes.[11],[21] The inconsistency of the results can be attributed to the influence of parameters such as other polymorphisms and the complex etiology of autoimmune diseases. We also observed a higher mean Plt count in rs10932037 CT that was not significant [Table 3]. According to the comparison between carriers of CC and CT genotypes, it seems that the decrease in ICOS function and attenuation of Tfh are related to the T allele. In contrast to our hypothesis, however, Haimila et al. showed that the presence of T allele (CT and TT) in kidney transplant recipients is associated with lower survival of grafted tissue.[27] Wu et al. showed that the TT genotype is associated with a lower overall survival in patients subjected to hematopoietic stem cell transplantation.[29] Indeed, both of these studies indicate a more pronounced immune reaction in carriers of minor T allele (RS10932037). On the other hand, no association was found between rs10932037 polymorphism with IgA deficiency.[30] Evaluation of other ITP indices such MPV and PDW did not show any association with genotypes of this study [Table 4]. However, there were a number of limitations in our research. First, due to the prevalence of ITP and the short period of the study, the sample size was low, especially in the chronic subgroup. Second, because of the absence of rs10932036 TT and rs10932037 TT genotypes in our study population, it was not possible to assess its effect on ITP. Third, few studies have addressed the polymorphisms with which we were concerned. Therefore, further studies with larger sample sizes are required to draw conclusions.


  Conclusion Top


Although our investigation of rs10932037, rs4404254, and rs10932036 polymorphisms of ICOS gene had no significant correlation with the chance of ITP among an Iranian population, we do note that people carrying the heterozygous rs4404254CC polymorphism have higher Plt counts at diagnosis both in the chronic and acute groups, suggesting better prognosis in them.

Acknowledgment

This work was financially supported by grant TH97/15 from vice chancellor for Research Affairs of Ahvaz Jundishapur University of Medical Sciences. This paper is issued from the thesis of Daryush Purrahman.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
LeVine DN, Brooks MB. Immune thrombocytopenia (ITP): Pathophysiology update and diagnostic dilemmas. Vet Clin Pathol 2019;48 Suppl 1:17-28.  Back to cited text no. 1
    
2.
Goette NP, Glembotsky AC, Lev PR, Grodzielski M, Contrufo G, Pierdominici MS, et al. Platelet apoptosis in adult immune thrombocytopenia: Insights into the mechanism of damage triggered by auto-antibodies. PLoS One 2016;11:e0160563.  Back to cited text no. 2
    
3.
Li J, Sullivan JA, Ni H. Pathophysiology of immune thrombocytopenia. Curr Opin Hematol 2018;25:373-81.  Back to cited text no. 3
    
4.
Audia S, Mahévas M, Samson M, Godeau B, Bonnotte B. Pathogenesis of immune thrombocytopenia. Autoimmun Rev 2017;16:620-32.  Back to cited text no. 4
    
5.
Moulis G, Audemard-Verger A, Arnaud L, Luxembourger C, Montastruc F, Gaman AM, et al. Risk of thrombosis in patients with primary immune thrombocytopenia and antiphospholipid antibodies: A systematic review and meta-analysis. Autoimmun Rev 2016;15:203-9.  Back to cited text no. 5
    
6.
Liu X, Hou Y, Peng J. Advances in immunopathogenesis of adult immune thrombocytopenia. Front Med 2013;7:418-24.  Back to cited text no. 6
    
7.
Furudoï A, Rivière É, Lazaro E, Furudoï E, Viallard JF, Parrens M. Adult primary immune thrombocytopenia: Spleen histology findings and outcomes according to rituximab use based on analysis of 41 cases. Am J Surg Pathol 2018;42:401-12.  Back to cited text no. 7
    
8.
Hemati Z, Kiani D. The relationship between self-esteem and quality of life of patients with idiopathic thrombocytopenic purpura at Isfahan's Sayed Al-Shohada Hospital, Iran, in 2013. Int J Hematol Oncol Stem Cell Res 2016;10:79-84.  Back to cited text no. 8
    
9.
Ji X, Zhang L, Peng J, Hou M. T cell immune abnormalities in immune thrombocytopenia. J Hematol Oncol 2014;7:72.  Back to cited text no. 9
    
10.
Li H, Hao Y, Zhang D, Liu W, Li Y, Lyu M, et al. Numerical and functional defects in CD8+CD28 − T-suppressor lymphocytes from patients with primary immune thrombocytopenia. Br J Haematol 2017;178:292-301.  Back to cited text no. 10
    
11.
Shin MK, Im SH, Park HJ, Kim SK, Yim SV, Chung JH, et al. Association study between polymorphisms of CD28, CTLA4 and ICOS and non-segmental vitiligo in a Korean population. Exp Ther Med 2011;2:1145-9.  Back to cited text no. 11
    
12.
Xie J, Cui D, Liu Y, Jin J, Tong H, Wang L, et al. Changes in follicular helper T cells in idiopathic thrombocytopenic purpura patients. Int J Biol Sci 2015;11:220-9.  Back to cited text no. 12
    
13.
Cines DB, Bussel JB, Liebman HA, Luning Prak ET. The ITP syndrome: Pathogenic and clinical diversity. Blood 2009;113:6511-21.  Back to cited text no. 13
    
14.
Abadi U, Yarchovsky-Dolberg O, Ellis MH. Immune thrombocytopenia: Recent progress in pathophysiology and treatment. Clin Appl Thromb Hemost 2015;21:397-404.  Back to cited text no. 14
    
15.
Chen Z, Zhou Z, Chen X, Xu J, Liu A, Du W, et al. Single nucleotide polymorphism in DNMT3B promoter and the risk for idiopathic thrombocytopenic purpura in Chinese population. J Clin Immunol 2008;28:399-404.  Back to cited text no. 15
    
16.
Yang J, Liu J, Chen Y, Tang W, Bo K, Sun Y, et al. Investigation of ICOS, CD28 and CD80 polymorphisms with the risk of hepatocellular carcinoma: A case-control study in eastern Chinese population. Biosci Rep 2019;39.  Back to cited text no. 16
    
17.
Van DV, Bauer L, Kroczek RA, Hutloff A. ICOS costimulation differentially affects T cells in secondary lymphoid organs and inflamed tissues. Am J Respir Cell Mol Biol 2018;59:437-47.  Back to cited text no. 17
    
18.
Eyada TK, Farawela HM, Khorshied MM, Shaheen IA, Selim NM, Khalifa IA. FcγRIIa and FcγRIIIa genetic polymorphisms in a group of pediatric immune thrombocytopenic purpura in Egypt. Blood Coagulat Fibrinolysis 2012;23:64-8.  Back to cited text no. 18
    
19.
Bouwhuis MG, Gast A, Figl A, Eggermont AM, Hemminki K, Schadendorf D, et al. Polymorphisms in the CD28/CTLA4/ICOS genes: Role in malignant melanoma susceptibility and prognosis? Cancer Immunol Immunother 2010;59:303-12.  Back to cited text no. 19
    
20.
Frydecka I, Karabon L, Jedynak A, Tomkiewicz A, Pawlak E, Wolowiec D, et al. ICOS gene Polymorphisms in B-Cell Chronic Lymphocytic Leukemia in a Polish Population. American Society of Hematology; 2010.  Back to cited text no. 20
    
21.
Kim YO, Kim HJ, Kim SK, Chung JH, Hong SJ. Association of the CD28/CTLA4/ICOS polymorphisms with susceptibility to rheumatoid arthritis. Clin Chem Lab Med 2010;48:345-53.  Back to cited text no. 21
    
22.
Walker EJ, Hirschfield GM, Xu C, Lu Y, Liu X, Lu Y, et al. CTLA4/ICOS gene variants and haplotypes are associated with rheumatoid arthritis and primary biliary cirrhosis in the Canadian population. Arthritis Rheum 2009;60:931-7.  Back to cited text no. 22
    
23.
D'Amico F, Fiorito G, Skarmoutsou E, Granata M, Rossi GA, Trovato C, et al. FOXP3, ICOS and ICOSL gene polymorphisms in systemic sclerosis: FOXP3 rs2294020 is associated with disease progression in a female Italian population. Immunobiology 2018;223:112-7.  Back to cited text no. 23
    
24.
Higuchi T, Oka S, Furukawa H, Nakamura M, Komori A, Abiru S, et al. Association of a single nucleotide polymorphism upstream of ICOS with Japanese autoimmune hepatitis type 1. J Hum Genet 2017;62:481-4.  Back to cited text no. 24
    
25.
Kaartinen T, Lappalainen J, Haimila K, Autero M, Partanen J. Genetic variation in ICOS regulates mRNA levels of ICOS and splicing isoforms of CTLA4. Mol Immunol 2007;44:1644-51.  Back to cited text no. 25
    
26.
Mao Y, Wang C, Meng F, Kong J, Cao S, Jiang Y, et al. Polymorphisms in the ICOS/CD28-ICOSL pathway are related to capecitabine-based chemotherapy response in advanced colon cancer patients. Mol Immunol 2018;96:78-82.  Back to cited text no. 26
    
27.
Haimila K, Turpeinen H, Alakulppi NS, Kyllönen LE, Salmela KT, Partanen J. Association of genetic variation in inducible costimulator gene with outcome of kidney transplantation. Transplantation 2009;87:393-6.  Back to cited text no. 27
    
28.
Kim HJ, Chung JH, Kang S, Kim SK, Cho BS, Kim SD, et al. Association of CTLA4, CD28 and ICOS gene polymorphisms with clinicopathologic characteristics of childhood IgA nephropathy in Korean population. J Genet 2011;90:151-5.  Back to cited text no. 28
    
29.
Wu J, Tang JL, Wu SJ, Lio HY, Yang YC. Functional polymorphism of CTLA-4 and ICOS genes in allogeneic hematopoietic stem cell transplantation. Clin Chim Acta 2009;403:229-33.  Back to cited text no. 29
    
30.
Haimila K, Einarsdottir E, de Kauwe A, Koskinen LL, Pan-Hammarström Q, Kaartinen T, et al. The shared CTLA4-ICOS risk locus in celiac disease, IgA deficiency and common variable immunodeficiency. Genes Immun 2009;10:151-61.  Back to cited text no. 30
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Subjects and Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed310    
    Printed5    
    Emailed0    
    PDF Downloaded1    
    Comments [Add]    

Recommend this journal